Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 561849
End position: 561875
Length: 27

DNA sequence
>NC_021738, from 561849 to 561875 (27 bp); Mannheimia haemolytica D171 CATTCCGCCCATTCCCCCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 561844-563484	Sequence	J450_02550 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 563484 to 561844)