Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 393482
End position: 393511
Length: 30

DNA sequence
>NC_021738, from 393482 to 393511 (30 bp); Mannheimia haemolytica D171 ATTATTATTTTTATAATTAGTATTATTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 392871-393917	Sequence	J450_01775 - hypothetical protein (Protein is coded in complementary strand; from 393917 to 392871)