Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 888996
End position: 889025
Length: 30

DNA sequence
>NC_021738, from 888996 to 889025 (30 bp); Mannheimia haemolytica D171 ATTATTATTTTTATAATTAGTATTATTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 888385-889431	Sequence	J450_04065 - hypothetical protein (Protein is coded in complementary strand; from 889431 to 888385)