Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 1638342
End position: 1638374
Length: 33

DNA sequence
>NC_021738, from 1638342 to 1638374 (33 bp); Mannheimia haemolytica D171 GAGTATCCATAGAGTCTCCATAGAGTCTCCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1637570-1638352	Sequence	J450_07820 - transporter (Protein is coded in complementary strand; from 1638352 to 1637570)