Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 553420
End position: 553455
Length: 36

DNA sequence
>NC_021738, from 553420 to 553455 (36 bp); Mannheimia haemolytica D171 CCTGCTGCATTTGCTGCTGCATTTGCTGCTGCGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 553069-553542	Sequence	J450_02495 - membrane protein (Protein is coded in complementary strand; from 553542 to 553069)