Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 1216751
End position: 1216795
Length: 45

DNA sequence
>NC_021738, from 1216751 to 1216795 (45 bp); Mannheimia haemolytica D171 TTTTTCTCAGCCCAATTTTTCTCAGCCCAGTTTTTATCAGCCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1216613-1217203	Sequence	J450_05800 - AcrR family transcriptional regulator (Protein is coded in complementary strand; from 1217203 to 1216613)