Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 2453948
End position: 2454001
Length: 54

DNA sequence
>NC_021738, from 2453948 to 2454001 (54 bp); Mannheimia haemolytica D171 TTGGCTTAAGTCTTCAAATTGGCTTAAGTCTTCAAATTGGCTTAAGTCTTCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2453892-2454254	Sequence	J450_11900 - preprotein translocase subunit SecG (Protein is coded in complementary strand; from 2454254 to 2453892)