Sequence retrieval

Genome: Streptococcus pyogenes HSC5
Start position: 726711
End position: 726734
Length: 24

DNA sequence
>NC_021807, from 726711 to 726734 (24 bp); Streptococcus pyogenes HSC5 ACAGCACCAGCAACAGTAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 726612-726788	Sequence	L897_03780 - hypothetical protein (Protein is coded in complementary strand; from 726788 to 726612)