Sequence retrieval

Genome: Streptococcus pyogenes HSC5
Start position: 1153261
End position: 1153290
Length: 30

DNA sequence
>NC_021807, from 1153261 to 1153290 (30 bp); Streptococcus pyogenes HSC5 ACTGTCATGCACTGTTATTCACTGTCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1153286-1153705	Sequence	L897_05965 - hypothetical protein (Protein is coded in complementary strand; from 1153705 to 1153286)