Sequence retrieval

Genome: Streptococcus pyogenes HSC5
Start position: 1343145
End position: 1343171
Length: 27

DNA sequence
>NC_021807, from 1343145 to 1343171 (27 bp); Streptococcus pyogenes HSC5 TTTTCAAACTTTTCAAAGTTTTCAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1342893-1343810	Sequence	L897_06935 glyQ glycyl-tRNA synthase subunit alpha (Protein is coded in complementary strand; from 1343810 to 1342893)