Sequence retrieval

Genome: Streptococcus pyogenes HSC5
Start position: 1551859
End position: 1551888
Length: 30

DNA sequence
>NC_021807, from 1551859 to 1551888 (30 bp); Streptococcus pyogenes HSC5 TTCTTCATCTTCTTCATCTTCTTCGTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1551848-1552423	Sequence	L897_08055 - DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 1552423 to 1551848)