Sequence retrieval

Genome: Streptococcus pyogenes HSC5
Start position: 1660556
End position: 1660591
Length: 36

DNA sequence
>NC_021807, from 1660556 to 1660591 (36 bp); Streptococcus pyogenes HSC5 TTTTTCTGGTTTAGTTTCTGGTTTTTTGTCTGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1660317-1663871	Sequence	L897_08565 - peptidase C5 (Protein is coded in complementary strand; from 1663871 to 1660317)