Sequence retrieval

Genome: Streptococcus pyogenes HSC5
Start position: 319931
End position: 319960
Length: 30

DNA sequence
>NC_021807, from 319931 to 319960 (30 bp); Streptococcus pyogenes HSC5 ATGGCAAATAAAGGCAAGTAATGGCTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 319307-320344	Sequence	L897_01745 - ferrichrome ABC transporter permease (Protein is coded in complementary strand; from 320344 to 319307)