Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 1139585
End position: 1139620
Length: 36

DNA sequence
>NC_021823, from 1139585 to 1139620 (36 bp); Listeria monocytogenes strain C1-387 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1139567-1140022	Sequence	M642_05940 - general stress protein (Protein is coded in complementary strand; from 1140022 to 1139567)