Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 1366763
End position: 1366786
Length: 24

DNA sequence
>NC_021823, from 1366763 to 1366786 (24 bp); Listeria monocytogenes strain C1-387 GCATCCGCATCCGCATCCGCATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1364558-1368367	Sequence	M642_07085 - hypothetical protein (Protein is coded in complementary strand; from 1368367 to 1364558)