Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 1596759
End position: 1596791
Length: 33

DNA sequence
>NC_021823, from 1596759 to 1596791 (33 bp); Listeria monocytogenes strain C1-387 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1596439-1596966	Sequence	M642_08190 - septum formation initiator (Protein is coded in complementary strand; from 1596966 to 1596439)