Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 180334
End position: 180373
Length: 40

DNA sequence
>NC_021823, from 180334 to 180373 (40 bp); Listeria monocytogenes strain C1-387 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 179871-180791	Sequence	M642_01005 - Motility gene repressor mogR (Protein is coded in complementary strand; from 180791 to 179871)