Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 1842069
End position: 1842092
Length: 24

DNA sequence
>NC_021823, from 1842069 to 1842092 (24 bp); Listeria monocytogenes strain C1-387 CAGAATCAAAATCATAATCAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1841735-1842256	Sequence	M642_09405 - glutamine amidotransferase (Protein is coded in complementary strand; from 1842256 to 1841735)