Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 1885654
End position: 1885686
Length: 33

DNA sequence
>NC_021823, from 1885654 to 1885686 (33 bp); Listeria monocytogenes strain C1-387 TCTGTTGTTCGTTTGTTGTTCGTCTGTTGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1885120-1886049	Sequence	M642_09685 - replication protein (Protein is coded in complementary strand; from 1886049 to 1885120)