Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 1903425
End position: 1903448
Length: 24

DNA sequence
>NC_021823, from 1903425 to 1903448 (24 bp); Listeria monocytogenes strain C1-387 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1902575-1903486	Sequence	M642_09820 - pseudouridine-5'-phosphate glycosidase (Protein is coded in complementary strand; from 1903486 to 1902575)