Sequence retrieval

Genome: Listeria monocytogenes strain C1-387
Start position: 2132446
End position: 2132469
Length: 24

DNA sequence
>NC_021823, from 2132446 to 2132469 (24 bp); Listeria monocytogenes strain C1-387 ATCATCATCATCTTCATCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2132357-2132893	Sequence	M642_11015 - DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 2132893 to 2132357)