Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 1023907
End position: 1023933
Length: 27

DNA sequence
>NC_021825, from 1023907 to 1023933 (27 bp); Listeria monocytogenes strain J2-1091 AGAAAAAGCAGATAAAGCAGAAAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1022226-1024055	Sequence	M638_05365 - cell wall surface anchor protein