Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 1092618
End position: 1092641
Length: 24

DNA sequence
>NC_021825, from 1092618 to 1092641 (24 bp); Listeria monocytogenes strain J2-1091 TTTGTATTAGTATTGGTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1092198-1093631	Sequence	M638_05700 - peptigoglycan-binding protein LysM (Protein is coded in complementary strand; from 1093631 to 1092198)