Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 1168567
End position: 1168593
Length: 27

DNA sequence
>NC_021825, from 1168567 to 1168593 (27 bp); Listeria monocytogenes strain J2-1091 TTCAGGAGCCTCAGGAGCCTCAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1168484-1169470	Sequence	M638_06060 - membrane protein (Protein is coded in complementary strand; from 1169470 to 1168484)