Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 1191427
End position: 1191466
Length: 40

DNA sequence
>NC_021825, from 1191427 to 1191466 (40 bp); Listeria monocytogenes strain J2-1091 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1190964-1191884	Sequence	M638_06190 - Motility gene repressor mogR (Protein is coded in complementary strand; from 1191884 to 1190964)