Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 1580105
End position: 1580129
Length: 25

DNA sequence
>NC_021825, from 1580105 to 1580129 (25 bp); Listeria monocytogenes strain J2-1091 TTTTTTTATTTTTTATCTTTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1580111-1580998	Sequence	M638_08165 - UTP--glucose-1-phosphate uridylyltransferase (Protein is coded in complementary strand; from 1580998 to 1580111)