Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 1852000
End position: 1852024
Length: 25

DNA sequence
>NC_021825, from 1852000 to 1852024 (25 bp); Listeria monocytogenes strain J2-1091 TTTTTTTTATTTTTCTTTCTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1852007-1852834	Sequence	M638_09610 - OxaA precursor (Protein is coded in complementary strand; from 1852834 to 1852007)