Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 2317751
End position: 2317780
Length: 30

DNA sequence
>NC_021825, from 2317751 to 2317780 (30 bp); Listeria monocytogenes strain J2-1091 TCAGCATCAGCATCAGCATCAGCATCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2316785-2319208	Sequence	M638_11860 - hypothetical protein (Protein is coded in complementary strand; from 2319208 to 2316785)