Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 2550002
End position: 2550034
Length: 33

DNA sequence
>NC_021825, from 2550002 to 2550034 (33 bp); Listeria monocytogenes strain J2-1091 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2549682-2550209	Sequence	M638_12950 - septum formation initiator (Protein is coded in complementary strand; from 2550209 to 2549682)