Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 2767059
End position: 2767088
Length: 30

DNA sequence
>NC_021825, from 2767059 to 2767088 (30 bp); Listeria monocytogenes strain J2-1091 AATAAGGAAAATAAAGGAAAAATCTGGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2765575-2767461	Sequence	M638_14015 - transporter (Protein is coded in complementary strand; from 2767461 to 2765575)