Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 2839924
End position: 2839959
Length: 36

DNA sequence
>NC_021825, from 2839924 to 2839959 (36 bp); Listeria monocytogenes strain J2-1091 TTGGTTCTTCTTTTGGTTCTTCGATTTTTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2839860-2841935	Sequence	M638_14370 - cell division protein FtsH (Protein is coded in complementary strand; from 2841935 to 2839860)