Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 2877060
End position: 2877083
Length: 24

DNA sequence
>NC_021825, from 2877060 to 2877083 (24 bp); Listeria monocytogenes strain J2-1091 TGATGATGATGATGACGATGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2876773-2877999	Sequence	M638_14545 - hypothetical protein (Protein is coded in complementary strand; from 2877999 to 2876773)