Sequence retrieval

Genome: Listeria monocytogenes strain J2-1091
Start position: 2974258
End position: 2974293
Length: 36

DNA sequence
>NC_021825, from 2974258 to 2974293 (36 bp); Listeria monocytogenes strain J2-1091 TCTTTTGTTGTTTCATTTGCTGTTTCTTTAGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2969134-2975013	Sequence	M638_15000 - hypothetical protein (Protein is coded in complementary strand; from 2975013 to 2969134)