Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 485365
End position: 485388
Length: 24

DNA sequence
>NC_021840, from 485365 to 485388 (24 bp); Listeria monocytogenes strain J1926 TTTGTATTAGTATTGGTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 484963-486378	Sequence	M645_02400 - peptigoglycan-binding protein LysM (Protein is coded in complementary strand; from 486378 to 484963)