Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 1257299
End position: 1257323
Length: 25

DNA sequence
>NC_021840, from 1257299 to 1257323 (25 bp); Listeria monocytogenes strain J1926 TTTTTTTTATTTTTCTTTCTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1257306-1258133	Sequence	M645_06400 - OxaA precursor (Protein is coded in complementary strand; from 1258133 to 1257306)