Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 975598
End position: 975622
Length: 25

DNA sequence
>NC_021840, from 975598 to 975622 (25 bp); Listeria monocytogenes strain J1926 TTTTTTTATTTTTTATCTTTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 975604-976491	Sequence	M645_04890 - UTP--glucose-1-phosphate uridylyltransferase (Protein is coded in complementary strand; from 976491 to 975604)