Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 1497093
End position: 1497128
Length: 36

DNA sequence
>NC_021840, from 1497093 to 1497128 (36 bp); Listeria monocytogenes strain J1926 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1497075-1497530	Sequence	M645_07515 - general stress protein (Protein is coded in complementary strand; from 1497530 to 1497075)