Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 1610216
End position: 1610251
Length: 36

DNA sequence
>NC_021840, from 1610216 to 1610251 (36 bp); Listeria monocytogenes strain J1926 TTGGTTCTTCTTTTGGTTCTTCGATTTTTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1610152-1612227	Sequence	M645_08095 - cell division protein FtsH (Protein is coded in complementary strand; from 1612227 to 1610152)