Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 1745012
End position: 1745047
Length: 36

DNA sequence
>NC_021840, from 1745012 to 1745047 (36 bp); Listeria monocytogenes strain J1926 TCTTTTGTTGTTTCATTTGCTGTTTCTTTAGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1739888-1745767	Sequence	M645_08730 - hypothetical protein (Protein is coded in complementary strand; from 1745767 to 1739888)