Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 215582
End position: 215617
Length: 36

DNA sequence
>NC_021840, from 215582 to 215617 (36 bp); Listeria monocytogenes strain J1926 GTTTTGTTGCTTGTTTTGTTGCTGTTTTTGTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 215452-216708	Sequence	M645_01035 - cell wall surface anchor protein (Protein is coded in complementary strand; from 216708 to 215452)