Sequence retrieval

Genome: Listeria monocytogenes strain J1926
Start position: 576002
End position: 576041
Length: 40

DNA sequence
>NC_021840, from 576002 to 576041 (40 bp); Listeria monocytogenes strain J1926 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 575539-576459	Sequence	M645_02865 - Motility gene repressor mogR (Protein is coded in complementary strand; from 576459 to 575539)