Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 197661
End position: 197684
Length: 24

DNA sequence
>NC_021902, from 197661 to 197684 (24 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 TTTCTTGTTCTTTTTGTTGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 197105-197788	Sequence	SN31241_1920 - lipoprotein (Protein is coded in complementary strand; from 197788 to 197105)