Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 2852851
End position: 2852874
Length: 24

DNA sequence
>NC_021902, from 2852851 to 2852874 (24 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 CGGTTTCGGTTTCGGCTTGGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2852441-2853163	Sequence	SN31241_28200 - Protein tonB (Protein is coded in complementary strand; from 2853163 to 2852441)