Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 3683443
End position: 3683466
Length: 24

DNA sequence
>NC_021902, from 3683443 to 3683466 (24 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 CGTTGGCGCTGGCGTTTGCGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3683042-3684052	Sequence	SN31241_36300 - Cytoskeleton protein rodZ (Protein is coded in complementary strand; from 3684052 to 3683042)