Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 3761898
End position: 3761921
Length: 24

DNA sequence
>NC_021902, from 3761898 to 3761921 (24 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 GCTGCGGCTGCCGATGCGGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3760368-3762740	Sequence	SN31241_37010 - Side tail fiber protein (Protein is coded in complementary strand; from 3762740 to 3760368)