Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 104828
End position: 104854
Length: 27

DNA sequence
>NC_021902, from 104828 to 104854 (27 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 GCGCCCGGCGCGCCAGGCGCGCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 104082-105464	Sequence	SN31241_1030 - 6-phospho-beta-glucosidase gmuD (Protein is coded in complementary strand; from 105464 to 104082)