Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 4454711
End position: 4454737
Length: 27

DNA sequence
>NC_021902, from 4454711 to 4454737 (27 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 CGCGCGACCGGCGCGACCCGCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4453857-4455746	Sequence	SN31241_44030 - Cold-shock DEAD box protein-A (Protein is coded in complementary strand; from 4455746 to 4453857)