Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 2261484
End position: 2261513
Length: 30

DNA sequence
>NC_021902, from 2261484 to 2261513 (30 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 ACGAAAAATAACCAGAAATAACAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2260544-2261698	Sequence	SN31241_22160 - Glucans biosynthesis protein C (Protein is coded in complementary strand; from 2261698 to 2260544)