Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 1696119
End position: 1696148
Length: 30

DNA sequence
>NC_021984, from 1696119 to 1696148 (30 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 TCCTGCTCCGTCATGCTCTGTACCGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1696059-1696322	Sequence	I137_07750 - tail protein (Protein is coded in complementary strand; from 1696322 to 1696059)