Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 2085341
End position: 2085364
Length: 24

DNA sequence
>NC_021984, from 2085341 to 2085364 (24 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 TCCGCAACCGCAGCCGCAGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2084879-2085832	Sequence	I137_09620 - electron transfer flavoprotein subunit beta (Protein is coded in complementary strand; from 2085832 to 2084879)